Nucleora / Tools / GC content calculator

GC content calculator

Overall GC with an explicit rule for ambiguity codes, GC at each codon position (GC3 included), a sliding-window scan with a band you set, and CpG observed/expected.

GCGC contentcomputed in this page

Input

Result

Sliding-window GC · shaded band = your low/high range

Method: counts of G, C and S over the bases allowed by the selected ambiguity rule; GC1 to GC3 over unambiguous bases at each codon position from nucleotide 1. Limit: GC1 to GC3 assume the sequence starts in frame. The band is a display aid you set; it is not a manufacturing specification.

METHOD

How it is calculated

GC content is the fraction of positions occupied by G or C. Ambiguity codes need a rule, and three are offered, defined as in Biopython's gc_fraction:

remove GC = (G + C + S) / (A + T + U + G + C + S + W) other codes leave the count ignore GC = (G + C + S) / length weighted GC = (G + C + S + Σ share(code)) / length share: R Y K M N = 1/2; B V = 2/3; D H = 1/3; W = 0

GC1, GC2 and GC3 are the GC fractions at the first, second and third positions of successive codons, counted from nucleotide 1 over unambiguous A, C, G and T only. GC3 tracks synonymous-site composition in a coding sequence.

window k covers nucleotides 1 + k·step .. k·step + w, for every window that fits; GC of each window uses the rule above CpG o/e = (number of CpG × N) / (number of C × number of G) (Gardiner-Garden & Frommer 1987)

U is read as T throughout.

Which calculation this page matches

Overall GC agrees with Biopython's gc_fraction(seq, "remove" | "ignore" | "weighted"), GC1 to GC3 with Bio.SeqUtils.GC123, and every window with gc_fraction on that slice.

References

  1. Gardiner-Garden M, Frommer M (1987) CpG islands in vertebrate genomes. J Mol Biol 196:261-282. doi:10.1016/0022-2836(87)90689-9
  2. Nomenclature Committee of the International Union of Biochemistry (1985) Nomenclature for incompletely specified bases in nucleic acid sequences. Eur J Biochem 150:1-5. doi:10.1111/j.1432-1033.1985.tb08977.x

WORKED EXAMPLE

A worked example, computed by this page

A synthetic 300-nt sequence with a GC-rich block and an AT-rich block inserted, scanned with a 30-nt window, step 1, "remove" rule:

GAAGTTGCCGTACTAAATTATGACAGCCGGGGATCTTCCCGCAAATAGGGAGGGTCGCAATCGCATCTAATTACCACATAGATTCAAGTCCCCGGGGGGGCCGGGGCCGGCGGCGCGGCGCGGCGGGCGGCCAGACTTGAGTACTCACTTATGTCGGACATTATTGGTGGGGCTATTGGATCGCGATAGTAAGACTATAGATTATAAAAATTTATTATAATAAAAAAATAAATTATTAAAAAGACGACCCTGCTGCGTCGTGATTGCCCGTTAAGTTCTGCGAGTCTGTATCTCTATATT
CompositionA 81 · C 62 · G 80 · T 77
Overall GC47.33 %
GC1 / GC2 / GC349.00 / 47.00 / 46.00 %
CpG o/e1.391 (23 CpG)
Windows271
Lowest window0.0 % at 201..230
Highest window100.0 % at 90..119
Windows outside 40–60 %126

The overall figure hides both inserted blocks; the window scan locates them.

WHERE THIS RUNS

The calculation runs in your browser

The arithmetic on this page is JavaScript executing in your browser. The sequence you enter is not sent anywhere: the calculator makes no network request with it, and there is no account, upload or server-side step. You can disconnect from the network after the page has loaded and the calculator keeps working.